Cómo hacer oligonucleótidos para PCR

Escrito por mark wallen | Traducido por erick velasquez centellas
  • Comparte
  • Twittea
  • Comparte
  • Pin
  • E-mail
Cómo hacer oligonucleótidos para PCR
(DNA image by Allyson Ricketts from Fotolia.com)

Para amplificar correctamente el ADN para la reacción en cadena de la polimerasa, necesitas dos moldes apropiados, o secciones pequeñas de nucleótidos que son complementarios al segmento de ADN que se está copiando. El PCR es utilizado para un grupo de aplicaciones que comprende desde el refuerzo de las leyes hasta la aplicación genética. Esto implica tomar una muestra de ADN de doble cadena, disolverlo para separarlo en dos filamentos, unir los moldes a los filamentos sueltos, y después extender los moldes para formar dos piezas de AND de doble cadena. Este proceso se repite con el fin de obtener una muestra varias veces la concentración de la original. El molde principal que estarás haciendo, debe coincidir con el ADN del lado opuesto, o cadena complementaria. En otras palabras, debe componerse de los primeros nucleótidos de tu secuencia de interés. El molde reverso tienen que unirse con la parte final del gen de tu interés y simular tu cadena complementaria.

Nivel de dificultad:
Moderadamente difícil


  1. 1

    Utilizando un procesador Word o un programa más especializado para ADN, busca la secuencia de ADN que tu quieres amplificar. Toma nota de los primeros 18-24 pares de bases y los últimos 18-24 pares de bases. Ello no deben ser hallados en cualquier región de tu muestra de ADN, lo cual puede ser común para áreas que se repiten a sí mismas. Si esto ocurre, terminarás con tu molde uniéndose a múltiples áreas dentro de tu muestra y resultados de PCR con largos variables.

  2. 2

    Escribe el primer y último segmento de ADN que estabas buscando en el primer paso. Por ejemplo, digamos que la secuencia inicial fue ATGGAATTCACGATCGATCGT y la final fue GGGTGCGAACACGGACTTAG. En este ejemplo, estamos haciendo moldes para el inicio y el final de un gen en particular.

  3. 3

    Toma la secuencia de los primeros 18-24 pares de genes (en el ejemplo, es ATGGAATTCACGATCGATCGT) e insértalo en otro documento para hacer el molde principal. Guárdalo con el nombre de la región en la que trabajas y el hecho de que es el molde principal.

  4. 4

    Escribe los últimos 18-24 pares de bases de la secuencia de interés ( en el ejemplo, GGGTGCGAACACGGACTTAG) para crear el molde reverso. Escribe los nucleótidos complementarios para la secuencia que representen el otro lado. Cada una de las cuatro bases de un nucleótido hacen par solamente con una base específica: adenina (A) con timina (T) y citocina (C) con guanina (G). Una vez que tienes la otra cadena complementaria, debes invertir el orden de todos los nucleótidos de la cadena, re-escribiéndolo en la dirección opuesta. Una vez completado esto, toma tu secuencia invertida y recientemente complementada y guárdala en un documento apropiadamente nombrado.

  5. 5

    Ve al sitio web de tu proveedor e inserta la secuencia con la información de facturación relevante (por lo general adjunto a un laboratorio), la concentración y las modificaciones especiales. Haz tu pedido.

Consejos y advertencias

  • Este proceso puede tomar muchos intentos para llegar al éxito. Sin embargo, los moldes pueden ser caros, entonces revisa dos veces tus moldes con alguien más experimentado en las primeras veces.
  • No mezcles las secuencias para muestras diferentes. Todo lo que toma es una confusión en los archivos que componen el primer error para la muestra equivocada.
  • Ten cuidado de que sólo porque alguien te dio una muestra de ADN / organismo y te dijo que estaba dentro de esta secuencia, no lo hace cierto. Si fue comprado de una empresa, puedes tener más confianza, pero los errores todavía pueden ocurrir.

No dejes de ver

Filtrar por:
  • Mostrar todos
  • Artículos
  • Galerías de fotos
  • Videos
  • Más relevante
  • Más popular
  • Más reciente

No se encuentran artículos disponibles

No se encuentran slideshows disponibles

No se encuentran videos disponibles